Главная страница «Первого сентября»Главная страница журнала «Биология»Содержание №23/2008

Курсы повышения квалификации

А. Г. Козленко

Информационная культура и/или компьютер на уроке биологии

Продолжение. См. № 17, 18, 19, 20, 21, 22/2008

Учебный план курса

№ газеты

Учебный материал

17

Лекция 1. Информационная культура учителя как высокое искусство авторизации

18

Лекция 2. Уровни работы с текстом на уроке биологии

19

Лекция 3. Математика в биологии: культура числовых заданий

Контрольная работа № 1

20

Лекция 4. Образ и звук: управление мультимедиа на уроке

21

Лекция 5. Биологическое видео: источники и цели применения

Контрольная работа № 2

22

Лекция 6. 3D-модели в биологии: оценка эффективности, анализ альтернатив

23

Лекция 7. Интерактивность на уроке биологии: уровни решений

24

Лекция 8. Оценивание как тест на информационную культуру

Итоговая работа

Лекция 7. Интерактивность на уроке биологии: уровни решений

Активное взаимодействие пользователя с учебным продуктом является главным преимуществом компьютерных технологий обучения. Представляется, что уровень интерактивности, другими словами – уровень активности пользователя при работе с электронным образовательным изданием/ресурсом, может служить одним из важнейших показателей развитости, качества ЭИР с методической точки зрения. Таким образом, рассматривать эффективность использования новых педагогических инструментов имеет смысл исходя из уровня интерактивности как базового инструмента компьютерной технологии обучения.

Осин А.В. Мультимедиа в образовании: контекст информатизации

Интерактивность – еще одно понятие, для которого отсутствует устоявшееся определение значения термина. Под интерактивностью в информационно-коммуникационных системах подразумевают способность такой системы самостоятельно, без участия человека, активно и разнообразно реагировать на действия пользователя (одной из граней приближаясь к понятию виртуальной реальности, однако не требуя, в отличие от нее, реалистичности и вовлеченности). Поэтому понятие интерактивности применимо не только к большим автономным системам (в т.ч. образовательным, где учет индивидуальных запросов, уровня подготовки и личностного профиля называется адаптивностью), но и к отдельным информационным объектам – компьютерным лабораторным работам, тренажерам и практикумам, исследовательским моделям. Интерактивные образовательные ресурсы достаточно широко представлены на образовательных компакт-дисках разных производителей. На рис. 7.1 показана модель «Волки и кролики» из продукта «Открытая Биология» ООО Физикон, позволяющая менять стартовые численности популяций и параметры рождаемости, в т.ч. в ходе работы модели, и функционирующая по заложенным в нее правилам клеточных автоматов. Большое количество таких объектов (наряду с неинтерактивными статичными рисунками, презентациями, анимациями и видео), созданных при реализации проектов Национального фонда подготовки кадров, доступны для использования школьными учителями, межшкольными и региональными методическими центрами через «Единое окно доступа к образовательным ресурсам» (http://window.edu.ru/).

Рис. 7.1. Интерактивная модель «Волки и кролики»

Рис. 7.1. Интерактивная модель «Волки и кролики»

Так как понятие информационно-коммуникационных систем, в свою очередь, также не очень определено и может быть распространено на любые автономные системы, в т.ч. учеников в классе, не стоит удивляться, когда по приказу районных органов управления образованием учитель младших классов проводит «интерактивный урок» вообще без компьютеров, проекторов и прочего цифрового оборудования. Объектами интерактивного взаимодействия на этом уроке (реальном!) выступали аналоговые пособия на доске, модифицировавшиеся по ходу занятия, впрочем, не самостоятельно, а руками учителя и учеников.

Сложность определения понятия интерактивности в компьютерном варианте обусловлена еще и тем, что диалогичность, на которой строится взаимодействие пользователя с современными операционными системами и прикладными программами, отличается от интерактивности неуловимо.

Задание 7.1. Постарайтесь сформулировать отличия диалогичности от интерактивности (в офисных программах и прикладном ПО, обсуждавшемся в ходе предыдущих лекций); запишите их в одном столбце таблицы. В другом столбце поясните, почему эти отличия не так существенны, как кажется на первый взгляд.

Самым распространенным примером интерактивных цифровых ресурсов являются виртуальные лаборатории и практикумы, призванные способствовать реализации деятельностного подхода в информационно насыщенном образовании. Они широко представлены в образовательных программных продуктах: электронные учебники и практикумы по физике и химии, уже упоминавшаяся «Открытая Биология 2.5» и другие продукты ООО Физикон, «Виртуальная лаборатория «Химия (8–11-й классы)» Лаборатории систем мультимедиа МарГТУ и других разработчиков и в Интернете1. Классифицировать виртуальные работы можно по ряду признаков.

1. Среда разработки, в которой выполнены модели:

– программы моделирования и отрисовки графики: 3D Studio MAX, Maya, LightWave, Adobe Photoshop, Corel Draw;
– программы для обеспечения интерактивности и программы-оболочки: Java, Adobe (Macromedia) Flash, Macromedia Director, GameStudio, Corel R.A.V.E. и др.

2. Реалистичность виртуальных лабораторий:

– двумерная графика (2D);
– трехмерная графика в двумерной среде (3D в 2D);
– трехмерная графика в виртуальной трехмерной среде (3D).

3. Способ взаимодействия с моделью (характер интерактивности).

4. Очевидность математической (физической, другой) основы моделирования объекта или явления.

5. Наличие автоматической проверки полученных результатов.

6. Характер модели (в терминах химического анализа):

А. Качественная – явления или опыты, обычно сложные или невыполнимые в условиях учебного заведения, последовательно воспроизводятся на экране, управляемые пользователем (от анимации или видео отличается использованием элементов управления и нелинейностью показа фрагментов, что приближает к интерактивному видео).

Б. Полуколичественная – в виртуальной лаборатории моделируется опыт, в ходе которого изменение отдельных характеристик (например, положения ползунка реостата в электрической цепи) вызывает изменения в работе установки, схемы, устройства (к этому типу относятся также имитационные стенды, на которых нужно предварительно «собрать» установку или схему).

В. Количественная (параметрическая) – в модели численно заданные параметры изменяют зависящие от них характеристики или моделируют явления (ввод значений скорости и направления движения тела позволяет получить график с траекторией и рядом рассчитанных характеристик).

Различия между полуколичественными и количественными моделями и имитационными стендами состоят в механизме изменения параметров: в чистой параметрической модели это делается с помощью компьютерных интерфейсных элементов управления (полосы прокрутки, открытые и закрытые списки, переключатели, выключатели, счетчики для набора численных значений, поля текстового ввода и т.п. – см. рис. 1.2); в полуколичественных имитируется как ввод данных, так и представление измеряемых величин на виртуальных приборах, копирующих реальные. В этом смысле виртуальные (не путать с цифровыми!) микроскопы, представленные на ряде сайтов (например, на портале Molecular Explorations2 реализован ряд имитаций разных типов микроскопов, включая трансмиссионный и сканирующий (рис. 7.2), электронные микроскопы, флуоресцентный микроскоп и другие), скорее могут быть отнесены к полуколичественным, а не к качественным или чисто количественным моделям.

Рис. 7.2. Виртуальный сканирующий электронный микроскоп на портале Molecular Explorations

Рис. 7.2. Виртуальный сканирующий электронный микроскоп на портале Molecular Explorations

Приведенная выше классификация (в первую очередь – характер моделей) влияет на урочное использование виртуальных лабораторных работ по отношению к реальным:

демонстрационное (перед реальной работой) использование: показать фронтально, с большого экрана или через мультимедийный проектор, последовательность действий реальной работы; предпочтительны реалистичные качественные и полуколичественные модели;
обобщающее (после реальной работы) использование: во фронтальном (демонстрация, уточнение вопросов, формулирование выводов и закрепление рассмотренного) или индивидуальном (математическая сторона экспериментов, анализ графиков и цифровых значений, изучение модели как способа отражения и представления реальности) режимах; предпочтительны количественные, параметрические модели;
экспериментальное (вместо реальной работы) использование: индивидуальное (в малых группах) выполнение заданий в виртуальной лаборатории без выполнения реальной работы, компьютерный эксперимент. Может выполняться как с реалистичными полуколичественными 3D-моделями, так и с параметрическими.

Задание 7.2. Найдите в ближайшей медиатеке органов управления образованием или в магазине образовательный программный продукт по биологии, содержащий интерактивные исследовательские модели и виртуальные практикумы. Попытайтесь классифицировать найденные объекты по разным принципам приведенной выше классификации и определить, как бы вы могли наиболее эффективно использовать их: 1) в компьютерном классе (для индивидуальных заданий), 2) в предметном кабинете (фронтальный режим).

Экспериментальное (вместо аналоговой работы) использование виртуальных практикумов и лабораторий ставит перед учителем ряд непростых задач. Во-первых, очевидно, что в большинстве виртуальных лабораторных работ отрабатываются не те умения и навыки, что в реальных работах; учитель вынужден оценить разницу и ее как-то компенсировать. Во-вторых, учителю придется (если модель достаточно сложная и действительно интерактивная) потратить немало времени на изучение того, как понимал использованную часть предметной области автор сценария модели и как это реализовали разработчики. Хорошо, если при создании были заложены (и описаны) какие-то проходилки, позволяющие сразу увидеть оптимальные сочетания параметров и соответствующий результат. Но понять, как модель вписывается в авторский курс, читаемый учителем, – тут никто не поможет… И, наконец, в-третьих, необходима изрядная авторизация деятельностей учеников: бывает, что очень хорошая (в плане «хорошести» – см. Лекцию 3) интерактивная модель пробуксовывает, уходит в песок без четко, подробно и пошагово прописанного задания по работе с ней. Как и в реальной лабораторной работе, в виртуальной необходимо учить навыкам исследования: выдвижению гипотез и их проверке, стандартизации условий, четкому фиксированию условий и результатов экспериментов, сначала в заготовленных учителем таблицах, печатных или электронных, потом – и самим ученикам делать таблицы, выбирать критерии, формат представления результатов, а затем и планировать, наконец, самостоятельную исследовательскую работу с интерактивом. Важным является отдельно развиваемое умение из арсенала критического мышления указывать границы (область, условия) применимости научных моделей, включая изучение того, какие аспекты реального явления компьютерная модель воспроизводит удачно, а какие оказываются за гранью моделируемого.

Создавать же интерактивные модели самостоятельно не посоветуешь: без времени, знаний и умения программировать да и зарплаты программиста учителю не тягаться с профессиональными разработчиками. Остается, ознакомившись со средствами разработки, сосредоточиться на применении готовых интерактивных моделей и практикумов…

Признанными лидерами среди средств создания интерактивов и анимаций являются продукты: Adobe (Macromedia) Flash, позволяющий программировать сложные траектории интерактивных взаимодействий и представлять анимированную графику в векторном формате, и Macromedia Shockwave Director Studio, эффективно управляющий 3D-объектами интерактивного взаимодействия: виртуальными лабораториями, тренажерами и симуляторами. В сочетании с разработанными для компьютерных игр средствами имитации физического мира (Havok Xtras) Shockwave позволяет создавать разработчикам образовательных продуктов виртуальные исследовательские среды с высокой достоверностью имитации процессов и явлений.

Adobe Flash – программа разработки мультимедийного наполнения (контента) для платформы Adobe Engagement Platform – такого, как web-приложения, игры и мультфильмы. Среда Adobe Flash ориентирована в большей мере на дизайнеров, аниматоров, хотя и имеется возможность писать полноценный код: в частности, математический аппарат Flash позволяет реализовать в создаваемом файле практически все, что может быть предложено и обсчитано в Microsoft Excel.

Flash-файлы имеют расширение .swf и просматриваются с помощью Adobe Flash Player, который распространяется бесплатно через сайт Adobe3 и устанавливается как плагин для броузеров (поэтому по ссылке на Flash-объект, например, из презентации и при установленном плагине будет открываться web-страница с соответствующим объектом). (Также swf-файлы можно просматривать с помощью плеера Gnash, полностью свободного Flash-плеера.) Исходные файлы с расширением .fla создаются в среде разработки Adobe Flash Professional, а потом компилируются в понимаемый Flash Player формат – swf. Кроме того, название Flash используется и в отношении одного из форматов видео (флешфильмы – Flash Movie) – формата .*flv, распространенного в Интернете благодаря Youtube и проигрываемого автономно FLV-плеером. Значительно менее распространены Flash-документы как один из форматов публикации текстов в Интернете.

В основе технологии Flash лежит векторный морфинг, то есть плавное «перетекание» одного ключевого кадра в другой. Это позволяет делать достаточно сложные мультипликационные сцены, задавая лишь несколько ключевых кадров для каждого персонажа. При создании объекта можно использовать медиа, звуковые и графические файлы, создавать интерактивные интерфейсы. Основной недостаток Flash-приложений – высокая требовательность к ресурсам процессора. Поэтому недостаточная мощность компьютера может повлиять на производительность операционной системы в целом либо привести к искажению результатов работы Flash-приложения, связанных с отображением анимации или подсчетом времени.

Объекты Flash могут быть вставлены на web-страницу (HTML-редакторами) – в таком виде они обычно и представлены в образовательных программных продуктах. Кроме того, их можно вставить в презентацию PowerPoint, причем не только ссылками на файлы, открывающиеся в новом окне (при этом обычно потребуются некоторые манипуляции с системой безопасности Windows, которая будет выражать сомнения в целесообразности этого действия), а и как внедренные в кадр самой презентации (ответ на один из вопросов задания 4.5). Сделать это можно так. В пункте меню Вид («View») – Панели инструментов («Toolbars») выбираем «Control Toolbox». Открывается панель инструментов «ActiveX Control toolbar» (рис. 7.3, 1). Выбираем иконку Другие («Control Toolbox», 2), откроется большой список разных «controls», установленных на вашем компьютере. Выбираем в списке «Shockwave Flash Object» (рис. 7.3, 3). При этом курсор мыши приобретает вид крестика (прицела). На кадре презентации рисуем область (рис. 7.3, 4) такого размера, как хочется, где будет проигрываться Flash-объект. После создания «окна» Flash нажимаем на нем правой кнопкой мыши и в контекстном меню выбираем Свойства («Properties»). Открывается большое диалоговое окно со свойствами Flash-объекта (рис. 7.3, 5), в первой строке выбираем «Custom» и нажимаем на кнопку с «...» справа от «Custom». При этом откроется диалоговое окно «Property Pages» (рис. 7.3, 6). Нужно указать имя и путь к файлу или – если SWF-файл находится в той же папке, что и презентация, – только его имя (рис. 7.3, 7). После этого нужно нажать «OK» в «Property Pages» (рис. 7.3, 8). При просмотре слайда Flash объект будет проигрываться так же, как и в Flash-плеере.

Рис. 7.3. Вставка Flash-объекта в кадр презентации (обозначения в тексте)

Рис. 7.3. Вставка Flash-объекта в кадр презентации (обозначения в тексте)

Главной альтернативой Adobe Flash в web-приложениях является использование JavaScript, который, к сожалению, не дает такой же гибкости и удобства разработки. Тем не менее среди понимающих английский язык популярна NetLogo4 – среда моделирования, содержащая большой набор готовых (и открытых для модификации) параметрических моделей (рис. 7.4) и клеточных автоматов.

Рис. 7.4. Модель «Волки и овцы» NetLogo, аналогичная (гомологичная?) модели 7.1

Рис. 7.4. Модель «Волки и овцы» NetLogo, аналогичная (гомологичная?) модели 7.1

Интерактивная доска5 – мощная современная система представления информации, управляемая компьютером и предназначенная для использования в процессе обучения, – постепенно становится все более распространенной в учреждениях образования. Интерактивная доска подсоединяется к компьютеру (через последовательный или USB порт и/или радиоканал) и к проектору и может крепиться на стене с помощью кронштейнов или устанавливаться на мобильной стойке для передвижения внутри помещения. Доска позволяет запускать на компьютере различные приложения (программы) и полностью управлять ими с поверхности доски; работать с мультимедиа: показывать слайды, видео; писать, рисовать, чертить различные схемы (как на обычной доске); в реальном времени наносить на проецируемое изображение пометки; вносить любые изменения и сохранять их в виде компьютерных файлов для дальнейшего показа или редактирования, печати на принтере.

Основная технологическая задача интерактивной доски – определение положения пишущего инструмента на ее поверхности. Для этого используются различные технологии: электромагнитные волны, резистивная матрица, реагирующая на прикосновение, оптическая (позиционирование при помощи видеокамер – технология DViT, Digital Vision Touch) и лазерная технологии, сочетание инфракрасной и ультразвуковой технологий.

В образовании наиболее распространены (по ряду причин: от стоимости до безопасности использования и надежности, вандалоустойчивости) два основных технологических решения.

1. Электромагнетик, основанный на изменении электромагнитных полей при прикосновении (приближении) специального пишущего устройства (стилуса, маркера): доски InterWrite Board, ACTIVboard. Такие доски отличаются большей вандалоустойчивостью (повреждение одного из участков доски не влияет на работоспособность всего устройства), высоким разрешением, высокой скоростью работы маркера, а также точным соответствием принципам работы с персональным компьютером (возможность вызова функций правой кнопкой мыши, реализация эффектов наведения на активный объект и др.).

2. Резистивная матрица – двухслойная сетка из проводников, разделенных воздушным зазором, которая вмонтирована в пластиковую поверхность доски; проводники замыкаются от давления на поверхность при прикосновении: доски SMART Board. Для работы с доской используется любой предмет – указка, маркер, палец докладчика.

Большинство производителей интерактивных досок предлагают наряду с самими досками набор других интерактивных устройств:

беспроводной планшет, позволяющий дистанционно управлять компьютером из любой точки класса, вести занятие, свободно перемещаясь по аудитории; передавать управление обучаемым (создание примечаний и обозначений без выхода к доске). Обеспечивает удобство в письме и точность рукописного текста;
интерактивная панель (небольшой активный экран на трибуне лектора) – обеспечивает управление объектами на доске при сохранении визуального контакта с аудиторией;
система интерактивного голосования (оперативного контроля знаний), включающая набор раздаваемых учащимся пультов для проведения индивидуального тестирования/опроса/голосования; пульты подключаются к компьютеру через интерактивную доску или отдельный приемник сигналов, а результаты опроса выводятся на экран и сохраняются в журнале результатов;
– встроенный принтер для распечатки объектов с интерактивной доски и др.

Это позволяет создать в образовательном учреждении ряд разных конфигураций кабинетов с интерактивным оборудованием (рис. 7.5).

Рис. 7.5. Конфигурации расположения интерактивных устройств в кабинетах разных типов

Рис. 7.5. Конфигурации расположения интерактивных устройств в кабинетах разных типов

Возможность управления всеми ресурсами компьютера (от просмотра изображений до вызова образовательных программных продуктов и ресурсов Интернета) при работе с интерактивной доской производится с привычного для учителя рабочего места – учительской доски. Таким образом, учитель возвращается в свое привычное положение – лицом к классу, к ученикам – и может управлять как учебным процессом в целом, так и отдельными информационными ресурсами. При использовании интерактивной доски расширяются возможности эффективного использования компьютера для визуализации и представления данных за счет средств для улучшения понимания и усвоения материала: пояснения и метки по изображениям и видео, сохранение этапов многостадийных моделей, метки по интерактивным объектам и т.п. Однако у работы с интерактивной доской есть и свои недостатки (не говоря о главном – высокой стоимости самой доски). В первую очередь, это необходимость работать в луче проектора, направленном, как и взгляды учеников, на доску спереди (в новых конструкциях проекторов с хорошей оптикой это неудобство минимизируется за счет расположения проектора над доской).

В комплекте с интерактивной доской обычно поставляется и специализированное программное обеспечение, не только поддерживающее управление интерактивными устройствами, позволяющее создавать примечания в ходе занятия и т.д., но и обеспечивающее возможность сохранения и записи результатов работы, включая видео- и аудиозапись сопровождающей лекции и самого рабочего процесса. Создаваемые при этом файлы сохраняются как во внутреннем формате (например, GWB, FLP, QMF), так и в форматах PowerPoint, DOC, PDF, JPG/BMP/GIF, HTML. Как обучаемые, так и преподаватель могут вернуться к любому моменту лекции, другого занятия, чтобы восстановить в памяти важные моменты, а сама запись воспроизводит последовательность действий и общую атмосферу реального занятия. Наиболее важным для учителя здесь является то, что именно с интерактивной доской появляется возможность, не прибегая к программированию в сложных средах и независимо от разработчиков, создавать авторизованные фрагменты уроков, насыщенные интерактивным взаимодействием. Кроме того, обычно в поставляемое с интерактивной доской ПО включены и большие библиотеки объектов, которые могут быть использованны на уроках по разных предметам. Например, используя готовые изображения из Галереи Interwrite6 , можно создать собственный «Конструктор клетки», вращая или перемещая исходные объекты и дополняя их, если возникнет желание, любыми самостоятельно подобранными рисунками, фотографиями, моделями и т.п.

Рис. 7.6. Использование изображений галереи и ПО интерактивной доски

Рис. 7.6. Использование изображений галереи и ПО интерактивной доски

Эффективность разных решений можно рассмотреть на достаточно известной задаче, аналоговый вариант которой был опубликован в журнале «Биология в школе» еще в 1995 г.7 В задании предлагался палеоконструктор: набор костей некоего ископаемого ящера, из которого нужно было собрать цельный скелет и по мере сил «нарастить» мясо, т.е. восстановить внешний вид. В аналоговом варианте (даже при ксерокопировании с увеличением) задача решалась плохо: бумага – непрозрачный материал, а кости должны были местами перекрываться. После сканирования и сохранения каждой косточки в виде отдельного графического файла (в формате gif с прозрачным фоном) создать конструктор можно было тремя способами:

– сделать web-страницу с JavaScript, позволяющим перетягивать отдельные кости8: собирать скелет уже можно, но остальные действия – сохранение, дорисовывание – возможны только при помощи PrintScreen и Paint;
– сделать на Flash: добавляется возможность фиксации костей в «правильных» точках, возможность вращения костей (что, впрочем, в задаче не требуется), а также проверка на правильность – но не рисование;
– расположить на странице конспекта (флипчарте) интерактивной доски: тогда можно и собрать скелет (в т.ч. вращая при желании отдельные кости), и дорисовать любой сложности рисунок поверх собранного скелета (особенно с планшетом, на котором рисовать значительно удобнее) – но без автоматической проверки на правильность.

Задание 7.3. Оцените по 9-балльной шкале «хорошесть» данной задачи как урочной (учитывая текстовый сопроводительный вопрос: «Опишите среду обитания животного, способ питания и передвижения. Предположите, с какими проблемами в локомоции это животное могло сталкиваться и почему»). Выберите один из вариантов реализации задачи и предложите для него инструктивную карточку для индивидуальной работы в компьютерном классе с подключенным (и работающим) сетевым принтером.

Каждое полушарие… имеет свои собственные… отдельные ощущения, восприятия, мысли и идеи, полностью обособленные от соответствующих внутренних переживаний другого полушария. Каждое полушарие – левое и правое – имеет собственную отдельную цепь воспоминаний и усвоенных знаний, недоступных для другого. Во многих отношениях каждое из них имеет как бы отдельное собственное мышление.

Роджер Сперри, Нобелевский лауреат 1981 г.9

Более высоким уровнем истинной интерактивности, возможным в электронных образовательных продуктах (учебниках, курсах), является адаптивность, представляющая собой воплощение идеи индивидуализации и дифференциации обучения 1970–1980-х гг. Устоявшиеся к тому времени представления о межполушарном диалоге в сочетании с достаточно разработанным диагностическим инструментарием сыграли важную роль в образовании, показав дискриминационную природу каменско-советской (см. название труда Яна Амоса Каменского в первой лекции) системы образования для значительной части обучаемых и пути преодоления функции насилия в ней. Но о реальной индивидуализации (для каждого обучаемого!) речь не шла – и пока не идет, даже в электронных курсах, претендующих на адаптивность. Скорее предлагается кластеризация (выделение групп со сходными личностными профилями) и корректировка курсов для них.

Наиболее легко реализуемый вариант адаптивности – по уровню сложности (при всей неоднозначности понятия сложности). Обычно применяется к контрольно-измерительным материалам (КИМам) и предполагает последовательное увеличение сложности заданий в зависимости от успешности решения предшествовавших. В более продвинутом варианте предполагается адаптация траекторий прохождения теоретического материала, позволяющая какие-то из разделов курса углубить, а другие исключить. Курс в таком варианте состоит из маленьких смысловых единиц, концептов, из которых собирается индивидуальный набор и последовательность. О настоящей адаптивности можно будет говорить, когда в основу выбора и предъявления (а также способа предъявления!) будет положен набор личностных характеристик: особенности познавательной стратегии, развитость логического и пространственного мышления, разных форм памяти, уровень внимания и т.п. Также среди таких характеристик – особенности межполушарного диалога (ведущее полушарие: левополушарный, правополушарный, равнополушарный тип; полезависимый/поленезависимый стиль); ведущий канал информации (визуалы, аудиалы, кинестетики), особенности памяти и внимания и т.п.

Известно, что для левополушарных учащихся наиболее значима правая полусфера поля зрения и сочетание цветов на доске: темный фон и светлый мел; для правополушарных сочетание цветов должно быть обратным: светлая доска и темный мел; наиболее значима левая полусфера (с потерями при несоответствии до 30%). Показаны различия в восприятии пропорций: правое полушарие тяготеет к «золотому сечению» и стремится (в опытах по копированию прямоугольников) увеличить горизонталь, тогда как левое предпочитает вытянутые формы и «растягивает» изображение по вертикали10. И если на уроке реализовать две доски в разных частях класса почти невозможно, то электронные учебники вполне могут реализовать различия и в интерфейсе, и в подборе заданий. Например, адаптируемая образовательная система AES-CS11 для обучаемых с поленезависимым стилем учебной деятельности предлагает один вариант интерфейса (узкое вертикальное меню в левой части со списком тем и символами для обозначения истории прохождения, сложности и др.), а для полезависимых – другой (дерево курса в виде пространственной схемы, расположенное под рабочей областью; графические гиперссылки и навигация; учебный материал в виде ментальных карт, mind map – см. Лекцию 2).

Целесообразна такая последовательность предъявления заданий в рамках одной темы: сначала задания на преобладающий тип мышления (для обеспечения стартового успеха), затем тренировочные задания со сниженным весовым уровнем оценивания на минорно-полушарный тип мышления и выход (в идеале) на зачетные задания разных типов. Примеры можно продолжать…

Экскурс в идеальный мир адаптивного eLearning’а (впрочем, не имеющий пока хорошего доступного воплощения) полезен для перехода к обсуждению специфических информационно-биологических задач, решаемых как с ИКТ, так и без. Такой задачей, например, является изучение одного из величайших открытий биологии прошлого века – генетического кода, материала, обычно (к удивлению учителей) одинаково хорошо усваиваемого и двоечниками, и отличниками, и право-, и левополушарными. Материал этот интересен тем, что тут мы имеем дело с одним из немногих обращений школьных курсов к теории знаковых систем (код – это соответствие одних знаков другим). При изложении теории здесь наряду с математическим обоснованием необходимости трех нуклеотидов в кодоне (и логичным исторически более ранним вариантом кода с двумя значимыми нуклеотидами и третьим – разделителем) можно приводить примеры из истории техники (азбука Морзе, флажки морского Международного свода сигналов), и художественной литературы (А.Конан Дойль «Пляшущие человечки», Э.По «Золотой жук» и другие примеры, подобранные учащимися), и кино (например, из недавнего боевика «Особо опасен» – с описанием принципа кодирования имен мистическим ткацким станком). Для иллюстрации триплетности (а также знакомства с точечными мутациями, включая сдвиг рамки считывания) применима восхитительная фраза: ВОТЛЕСДУББУКИВЫБЫЛПАЛДЫМШЕЛТРИДНЯ12.

Хотя, как уже отмечалось, перекодировка руками не вызывает проблем, принципиально иначе к изучению генетического кода позволяет подойти онлайновая программа «Протеиновая машина» EMBOSS Transeq13 (рис. 7.7), созданная в Европейском институте биоинформатики. Программа переводит нуклеотидные последовательности в аминокислотные, и в ней реализован в виде выпадающих списков ряд дополнительных возможностей (выбора разных вариантов генетического кода: основной, бактериальный, митохондрий разных организмов и т.п.; выбор смысловой либо же комплементарной нити, сдвиг рамки считывания на 1–2 нуклеотида, применение цветовой символики для аминокислот).

Рис. 7.7. Окно онлайновой машиныпереводчика EMBOSS Transeq

Рис. 7.7. Окно онлайновой машиныпереводчика EMBOSS Transeq

В текстовое поле вводится последовательность нуклеотидов (из буфера обмена или файла в форматах генетических баз данных), и перевод осуществляется нажатием на расположенную ниже кнопку Run. В стартовых установках можно выбрать Colour – Yes (остальные предлагаемые параметры оптимальны). После этого программа переходит на следующую страницу, где представлен результат ее работы – соответствующая последовательность аминокислот полипептида (например, MGTTHHX: Метионин – Глицин – Треонин – Треонин – Гистидин – Гистидин – Валин; стоп-кодоны обозначаются знаком «*»).

Дальнейшее зависит от подготовленности класса и целей учителя: в простом варианте можно подобрать последовательности, иллюстрирующие каждое из теоретически рассмотренных свойств генетического кода. Например, для иллюстрации вырожденности – два фрагмента, различающиеся между собой по 11 позициям из 18 (AUGUCUAGAUUAGGCUCA и AUGAGCCGGCUCGGAAGU), и оценить количество аминокислотных различий в пептидах. Или, иллюстрируя неуниверсальность кода, предложить фрагмент (UACAGACCCAUAUGCGGUACUUGA) для перекодировки основным, «универсальным» кодом (Standard) и другим вариантом кода, характерным для митохондрий позвоночных Vertebrate Mitochondrial.

В полностью открытом варианте можно после минимальных теоретических сведений и задания направлений поиска предложить открыть свойства кода самостоятельно. Наконец, при высокой подготовке в области информатики (и олимпиадной мотивации) можно сравнить генетические коды разных систем и построить их филогенетическое древо (для этого могут быть привлечены статистические программы, например Statistica for Windows) или попытаться доказать по расположению стопкодонов в таблице кода разных организмов логическую возможность двухнуклеотидного «древнего» кода (что лучше делать на бумажной таблице кода 16х4).

Решение генетических задач по родословным представляется весьма важной и, главное, хорошей задачей, позволяющей объединить логические операции при решении генетических задач с графическим представлением родословных и развитием жизненных компетенций учеников (анализу наследования признаков в собственных семьях и элементам медико-генетического консультирования).

Решение задач по анализу родословных (даже в условиях лимита времени) редко вызывает проблемы: обычно рассматривается наследование моногенных признаков, а определить характер наследования признака (доминантный или рецессивный, аутосомный или сцепленный с полом) можно по простым свойствам встречаемости в родословной.

Рис. 7.8. Родословная для определения характера наследования признака и определения вероятности рождения больного ребенка у пробанда

Рис. 7.8. Родословная для определения характера наследования признака и определения вероятности рождения больного ребенка у пробанда14

Построение родословных возникло еще до ИКТ и достигло заметного успеха. Вместе с тем существует целый ряд программ-редакторов родословных, распространение которых обусловлено учебными задачами, профессиональными потребностями для нужд медико-генетического консультирования и социальными сервисами Интернета (подготовкой и публикацией во Всемирной сети собственных родословных, просматриваемых с помощью web-броузера). Хотя обычно программы сохраняют файлы в собственных форматах, общим (стандартным) является формат *.ged, при помощи которого можно файлы, сохраненные в одной программе, открыть (и редактировать) в другой.

При подготовке заданий с родословными для уроков (возможность сканирования страниц из книг как альтернатива в расчет не принималась) могут быть использованы три программы (табл. 7.1).

Таблица 7.1. Сравнительный анализ программ для работы с родословными

 

MS Paint (Microsoft)

GenoPro

MyHeritage Family Tree Builder

Размер дистрибутива

В составе ОС Windows

2,13 Мб

19,0 Мб

Стоимость

В цене ОС Windows

$49 (демоверсия; ознакомительная версия – 14 дней, версия для учебных заведений – 180 дней)

Бесплатно

Русификация и поддержка кириллицы

Есть

Есть

Есть

Публикация в Интернете

Нет

Есть

Есть

Экспорт в формат *.ged

Нет

Есть

Есть

Главное предназначение

Простейший графический редактор, в котором проще и быстрее всего нарисовать родословную и сделать подписи к ней

Достаточно мощная и многофункциональная программа, строящая родословные по правилам медико-генеа-логического анализа, с использованием медицинской символики

Программа для составления семейных родословных и интеграции документов и данных, а также для экспорта и представления результатов в Интернете

Особые достоинства

Простота

Широкий ассортимент демонстрируемых связей (в т.ч. эмоциональных, социальных и др.)

Хорошее сохранение файлов и back-up (возможность полного сохранения всего наработанного в одном отчуждаемом архиве). Экспорт в PDF и JPEG

Недостатки

Неудобно располагать объекты на одной линии – приходится рисовать направляющие линии другим цветом, а потом убирать ластиком или заливкой белым

Иногда некорректно работают связи между членами родословной, автокоррекция работает плохо, невозможно показать близкородственные браки

Программа не предназначена для медико-генетических задач, нет научной символики, именовать объекты родословной можно только в текстовых полях

 

Время создания родословной из 16 членов с обозначениями уровней и членов родословной, больных и носителей заболеваний

14 минут (рис. 7.8, с оптимизацией временных затрат путем копирования изображений из легенды)

15 минут (на основе опыта Visio и редактора диаграмм Word/PowerPoint), экспорт в графический формат через PrintScreen

9 минут (на родословной нет символики по состоянию здоровья и информацию нужно вносить текстом в одно из отображаемых полей)

Возможность привязки фотографий, документов, создания гиперссылок

Нет

Есть (хорошо реализована возможность создания многостраничного файла с гиперссылками между страницами)

Есть (удобное добавление медиаобъектов с редактированием их описаний, указанием людей на фото; интуитивно понятный интерфейс)

Пример в программе

Родословные героев «Поттерианы» Дж.К. Роулинг (рис. 7.9)

Родословная семьи Кеннеди

Цели урочного (околоурочного) использования

Рисование родословных для заданий, в т.ч. и как сами задания – ученики делают по рисунку подписи, обозначения генотипов, ответ на задачу и сохраняют под другим именем (возможность индивидуального выполнения заданий – достаточно указать каждому ученику номера его файлов с задачами).
Возможно рисование учениками родословных по описанию из условия задачи

Подготовка родословных к задачам, анализ родословных с добавлением текстовых комментариев.
Менее реально – создание учениками родословных по условию задач (относительно сложный функционал).
Возможность выполнения проектов по составлению больших родословных группами учащихся, в т.ч. с демонстрацией социальных связей и эмоциональных отношений (интегрированный проект с литературой – персонажи романа)

Большие проекты, в т.ч. распределенные, с использованием Интернета, интегрированные с историей (мировой художественной культурой, литературой), с изображениями, документами, привязками к историческим событиям и т.п.
У программы много пользователей в Интернете, что обеспечивает возможность интеграции с другими проектами (поиск родственников)

Рис. 7.9. Окно программы GenoPro с родословной Гарри Поттера

Рис. 7.9. Окно программы GenoPro с родословной Гарри Поттера

Задание 7.4. (Образная рефлексия.) Выполнив все предыдущие задания, оцените (в долях от единицы) и нарисуйте в предложенной системе координат параллелепипед полезности для вас данного занятия:

– по оси Х отложите новизну и полезность для вас теоретического материала лекции;
– по оси Y отложите новизну и полезность практических заданий (рост ИКТ-компетентности);
– по оси Z отложите собственное предметное приращение: свои идеи и возможные способы применения материала в урочной практике, возникшие у вас в ходе работы с лекцией (изменения в информационной культуре).

Достройте параллелепипед.

Рекомендуемая литература

Инге Унт. Индивидуализация и дифференциация обучения. – М.: Педагогика, 1990.

Осин А.В. Мультимедиа в образовании: контекст информатизации. – М.: Агентство «Издательский сервис», 2004.

Сиротюк А.Л. Нейропсихологическое и психофизиологическое сопровождение обучения. – М.: ТЦ Сфера, 2003.

Стародубцев В.А., Федоров А.Ф. Инновационная роль виртуальных лабораторных работ и компьютерных практикумов // Всероссийская конференция ‘ЕОИС-2003’ http://conf.sssu.ru/phorums/read.php?f=25&i=50&t=1

Ответы

Задание 7.1. Для примера (по крайней мере в одном из направлений поисков) назовем некоторые наиболее очевидные проявления интерактивности:
– сокращение числа отображаемых на панелях инструментов Word (при расположении в один ряд) иконок в зависимости от используемости (и сокращение пунктов выпадающих меню в сокращенном отображении);
– диалоговое окно DVD-плееров при повторной вставке DVD-диска в привод с выбором продолжить воспроизведение с того места, где просмотр был остановлен, или начать просмотр заново.

Задание 7.3. Узким местом простых решений является именно рисование внешнего вида. Поэтому этот этап работы лучше перебрасывать в бумажный вариант. Как и в задании по описанию экологической ниши несуществующего животного (в т.ч. при участии психолога, интерпретирующего его как проективный тест «Несуществующее животное»).

 


1 Crocodile http://www.crocodile-clips.com/index.htm; Biointeractive Virtual Labs http://www.hhmi.org/biointeractive/vlabs/index.html; GenLab http://www.virtual-labs.org/genlab/; демонстрации и лабораторные работы по физике http://www.ispu.ru/library/physics/java/index.html и др.

2 http://micro.magnet.fsu.edu/primer/virtual/virtual.html

3 http://www.adobe.com/shockwave/download/download.cgi?P1_Prod_Version=shockwaveflash

4 http://ccl.northwestern.edu/netlogo/download.shtml (58 Мб). На русском языке о NetLogo см. на Летописи.RU (http://letopisi.ru/index.php/NetLogo).

5 Ведущие производители интерактивного оборудования – компании Promethean (Великобритания, интерактивные доски ACTIVboard), Interwrite Learning (США, ИД Interwrite Board), SMART Technologies Inc. (Канада, SMART Board), Hitachi (Япония, ИД Hitachi Starboard), Polyvision (Корея, ИД PolyVision), Panasonic (Япония, копирующие и интерактивные доски Panasonic Panaboard) и др.

6 Программное обеспечение для ИД Interwrite Workspace Software (GTCO).

7 Боусли К. Упражнение по эволюции // Биология в школе. 1995. № 2.

8 Именно так поступил автор – см. http://www.kozlenkoa.narod.ru/paleo.htm (кнопка «Открыть окно»).

9 Блум Ф., Лейзерсон Н., Хофстедер Л. Мозг, разум и поведение. – М.: Мир, 1988.

10 Лотман Ю., Николаенко Н. «Золотое сечение» и проблемы внутримозгового диалога // Декоративное искусство СССР. 1983. № 9 (310).

11 AES-CS: Adaptive Educational System based on Cognitive Stiles Evangelos Triantofillou, Andreas Pomportsis, Ellisavet Georgiadou // Adaptive Systems for Web-based Education, Proceeding of AH’2002 Workshop on Adaptive Systems for Web-based Education, Malaga, Spain, may 2002, Selected papers, p. 10–21.

12 Гершензон С.М. Основы современной генетики. – Киев: Наукова думка, 1983.

13 http://www.ebi.ac.uk/Tools/emboss/transeq/

14 из: Збірник задач і вправ з біології: Навч. Посібник /А.Д. Тимченко, Ю.І. Бажора, Л.Г. Кириченко та ін. – Київ: Вища школа, 1992.

Рейтинг@Mail.ru